| |||||||||
In mathematics, a subsequence of a sequence X is a sequence formed from X by deleting some of the elements without disturbing the relative positions of the remaining elements. For example,
is a subsequence of
with corresponding index sequence <3,7,9,10>.
Given two sequences X and Y, a sequence G is said to be a common subsequence of X and Y, if G is a subsequence of both X and Y. For example, if
then common subsequence of X and Y could be
This would not be the longest common subsequence, since G only has length 3, and the common subsequence < B,E,E,B > has length 4. The longest common subsequence of X and Y is < B,E,G,C,E,B >
Subsequences have applications to computer science, especially in the discipline of Bioinformatics, where computers are used to compare, analyze, and store DNA strands.
Take two strands of DNA, say
ORG1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
ORG2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.
See also: subsequential limits, limsup, liminf